chimeric guide rna expression plasmid  (Addgene inc)

Journal: iScience

Article Title: A human blood-brain barrier model reveals pericytes as critical regulators of viral neuroinvasion

doi: 10.1016/j.isci.2025.114443

Figure Lengend Snippet: Generation and characterization of hPSC-derived neural crest pericytes (A) Schematic of differentiation of neural crest pericytes (NCC-PCs) from hPSCs. (B, D, F–H) Bulk RNA sequencing was performed on hPSCs, hPSC-derived neural crest cells (NCC), hPSC-derived NCC-PCs (NCC-PC), hPSC-derived mesoderm pericytes (M-PC), or primary CNS pericytes (Primary PC). H1 or iPS11 stem cells were used for all differentiations. All bar graphs show the mean value of three biological replicates; error bars show standard deviation. (B) Normalized RNA expression of PDGFRb. (C) Expression of PDGFRb quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (D) Normalized RNA expression of CSPG4 (NG2). (E) Immunofluorescence images of H1 hPSC-derived NCCs or H1 hPSC-derived NCC-PCs stained with an antibody directed against NG2. Scale bars = 100um. (F) Normalized RNA expression of CD44 (G), normalized RNA expression of CD146, and (H) normalized RNA expression of CD13. (I) Expression of CD13 quantified by flow cytometry on H1 or iPS11 hPSCs, NCCs, and NCC-PCs. (J) TEER values of H1 hPSC-derived BMEC-like cells plated in Transwell plates with or without H1 hPSC-derived NCC-PCs plated in the lower chamber. TEER was measured beginning at 0 h after the initiation of co-culture. TEER values were measured in three independent experiments. The fold change in TEER values from 0 to 48 h after the initiation of co-culture was quantified for each experiment and compared using an unpaired t test.

Article Snippet: For generation of fluorescently-tagged hPSC lines EGFP or tdTM was inserted into the AAVS1 locus with a targeting plasmid (Addgene; catalog no. 22212) and a human codon-optimized SpCas9 and chimeric guide RNA expression plasmid (Addgene; catalog no. 42230), into which the Target Guide Sequence was cloned into using the oligos: Oligo 1: CACCG GGGGCCACTAGGGACAGGAT,Oligo2 : AAAC ATCCTGTCCCTAGTGGCCCC C. After puromycin selection, EGFP or tdTM-expressing clones were manually picked.

Techniques: Derivative Assay, RNA Sequencing, Standard Deviation, RNA Expression, Expressing, Flow Cytometry, Immunofluorescence, Staining, Co-Culture Assay

Journal: iScience

Article Title: Targeting ROR2 homooligomerization disrupts ROR2-dependent signaling and suppresses stem-like cell properties of human breast adenocarcinoma

doi: 10.1016/j.isci.2024.111589

Figure Lengend Snippet:

Article Snippet: SpCas9 and chimeric guide RNA expression plasmid lenti-CRISPR v2 vector (Addgene) were used to generate stable ROR2 knockout cell-lines.

Techniques: Virus, Formalin-fixed Paraffin-Embedded, Recombinant, Mutagenesis, Cloning, Activation Assay, Gene Expression, Sequencing, Plasmid Preparation, Software, Imaging